1. Unger ER, Ruffin MT, Diaz-Arrastia C.Human papillomaviruses. In: Clinical Gynecology, Second Edition. 2015.p.37181. | |
2. Kofoed K, Sand C, Forslund ,MadsenK. | |
Prevalence of human papillomavirus in anal | |
and oral sites among patients with genital | |
warts. Acta Derm Venereol. 014;94(2):207- | |
https://doi.org/10.2340/00015555-1718 11. | |
3. Yuanyue L, Baloch Z, Yasmeen N,TaoY,Xiaomei W, Xueshan X. The distribution ofhuman papillomavirus | |
genotypes in cervicalcancer and intraepithelial neoplasia lesionsamong | |
Chinese women in Yunnan Province. JInfec | |
Public Health. 2018;11(1):105-10. | |
4. Camara HB, Anyanwu M, Wright E,Kimmitt PT. Human papilloma virus genotype distribution and risk factor analysis amongst reproductive-age women in urban Gambia. J Med Microbiol. 2018;67(11):1645-4.https://doi.org/10.1099/jmm.0.000848 |
|
5. Muñoz N, Bosch FX, De Sanjosé S, Herrero R, Castellsagué X, Shah K V., et al. | |
Epidemiologic classification of human | |
papillomavirus types associated with cervical cancer. N Engl J Med. 2003;348(6):518-27. https://doi.org/10.1056/NEJMoa021641 |
|
6. Lin CY, Chen HC, Lin RW, You SL, You CM, Chuang LC, et al. Quality assurance of genotyping array for detection and typing of human papillomavirus. J Virol Methods. 2007;140(1-2):1-9. https://doi.org/10.1016/j.jviromet.2006.10.004 |
|
7. Zuna RE, Allen RA, Moore WE, Lu Y, Mattu R, Dunn ST. Distribution of HPV | |
genotypes in 282 women with cervical lesions: Evidence for three categories of intraepithelial lesions based on morphology and HPV type. Mod Pathol. 2007;20(2):167-74. https://doi.org/10.1038/modpathol.3800723 |
|
8. Piana A, Sotgiu G, Castiglia P, Pischedda S,Cocuzza C, Capobianco G, Marras V, DessoleS, Muresu E. Prevalence and type distributionof human papillomavirus infection in womenfrom North Sardinia, Italy. BMC PublicHealth. 2011 Dec 1;11(1):785. https://doi.org/10.1186/1471-2458-11-785 |
|
9. Halfon P, Ravet S, Khiri H, Penaranda G, Lefoll C. Incident HPV 51 infection after prophylactic quadrivalent human papillomavirus (types 6, 11, 16, and 18)L1virus like particle vaccine Gardasil/silgard®.Clin Med Insights Case Reports. 2010;3:69- 71.https://doi.org/10.4137/CCRep.S508 | |
10. de Martel C, Plummer M, Vignat J, Franceschi S. Worldwide burden of cancer | |
attributable to HPV by site, country and HPV type. International journal of cancer. 2017 Aug 15;141(4):664-70. https://doi.org/10.1002/ijc.30716 |
|
11. Jalilvand S, Shoja Z, Hamkar R. Human papillomavirus burden in different cancers in Iran: a systematic assessment. Asian Pac J Cancer Prev. 2014 Jan 1;15(17):7029-35. https://doi.org/10.7314/APJCP.2014.15.17.7029 |
|
12. Ebrahimi A, Moradi MR, Rezaei M, Kavoussi H, Madani SH, Mohammadamini K, et al. Comparison of the risk factors and HPV types in males with anogenital warts with and without involvement of the urethral meatus in Western Iran. Acta Dermatovenerologica Alpina, Pannonica Adriat. 2017;26(3):55-8 | |
https://doi.org/10.15570/actaapa.2017.24 | |
13. Ozaydin-Yavuz G, Bilgili SG, | |
Guducuoglu H, Yavuz IH, Elibuyuk-Aksac S, Karadag AS. Determinants of high-risk human papillomavirus infection in anogenital warts. Postep Dermatologii i Alergol. 2019;36(1):76- 81. https://doi.org/10.5114/ada.2019.82915 |
|
14. Jamshidi M, Shekari M, Nejatizadeh AA, Malekzadeh K, Baghershiroodi M, Davudian P, et al. The impact of human papillomavirus (HPV) types 6, 11 in women with genital warts. Arch Gynecol Obstet. | |
2012;286(5):1261-7. | |
15. Dareng EO, Adebamowo SN, Famooto A, Olawande O, Odutola MK, Olaniyan Y, et al. Prevalence and incidence of genital warts and cervical Human Papillomavirus infections in Nigerian women 11 Medical and Health Sciences 1117 Public Health and Health Services. BMC Infect Dis. 2019;19(1):27. https://doi.org/10.1186/s12879-018-3582-y |
|
16. Salehi-Vaziri M, Sadeghi F, Hashemi FS, Haeri H, Bokharaei-Salim F, Monavari SH, et al. Distribution of human papillomavirus genotypes in Iranian women according to the severity of the cervical lesion. Iran Red Crescent Med J. 2016;18(4). https://doi.org/10.5812/ircmj.24458 |
|
17. Salehi-Vaziri M, Sadeghi F, Bokharaei- Salim F, Younesi S, Alinaghi S, Monavari SH, et al. The prevalence and genotype distribution of human | |
papillomavirus in the genital tract of | |
males in Iran. Jundishapur J Microbiol. | |
2015;8(12). | |
18. Jalilian S, Izadi B, Madani SH, Mohajeri P. The prevalence and genotype distribution of human papillomavirus types in the general female population in West of Iran. Jundishapur J Microbiol. 2017;10(3) :e40855. https://doi.org/10.5812/jjm.40855 |
|
19. Sohrabi A, Hajia M. Cervical cancer and genital infections: Assessment of performance and validation in human papillomavirus genotyping assays in Iran, its neighbouring countries and Persian gulf area. Iran J Pathol. 2017;12(1):35-44. https://doi.org/10.30699/ijp.2017.24229 |
|
20. Sohrabi A, Hajia M, Jamali F, Kharazi F. Is incidence of multiple HPV genotypes rising in genital infections? J Infect Public Health. 2017;10(6):730-3. https://doi.org/10.1016/j.jiph.2016.10.006 |
|
21. Comparetto C, Borruto F. Human papillomavirus infection: Overview. In: Handbook on Human Papillomavirus: Prevalence, Detection and Management. 2013. | |
22. Lytwyn A, Sellors JW. Sexually | |
transmitted human papillomaviruses: Current concepts and control issues. Can J Hum Sex. 1997;6(2):113-26. | |
23. Franco EL. Persistent HPV infection and cervical cancer risk: Is the scientific rationale for changing the screening paradigm enough? Journal of the National Cancer Institute. 2010;102(19):1451-3. https://doi.org/10.1093/jnci/djq357 |
|
24. Gissmann L, De Villiers E ‐M, Hausen H Zur. Analysis of human genital warts | |
(condylomata acuminata) and other genital | |
tumors for human papillomavirus type 6 DNA. Int J Cancer. 1982;29(2):143-6. https://doi.org/10.1002/ijc.2910290205 |
|
25. Ma L, Lu S, Jiang Y, Li M, Cong X, Cao Y. Distribution of human papillomavirus genotypes (2014-2016) in women with genital warts at a sexually transmitted disease clinic in Beijing, China. Future Virol. 2018;13(2):111 https://doi.org/10.2217/fvl-2017-0097 |
|
26. Favre M, Kremsdorf D, Jablonska S, Obalek S, Pehau‐Arnaudet Gér, Croissant O, et al. Two new human papillomavirus types | |
(HPV54 and 55) characterized from genital | |
tumours illustrate the plurality of genital HPVs. Int J Cancer. 1990;45(1):40-6. https://doi.org/10.1002/ijc.2910450109 |
|
27. Park SJ, Seo J, Ha SH, Jung GW. | |
Prevalence and determinants of high-risk | |
human papillomavirus infection in male genital warts. Korean J Urol. 2014;55(3):207-12. https://doi.org/10.4111/kju.2014.55.3.207 |
|
28. Robadi IA, Pharaon M, Ducatman BS. | |
The importance of high-risk human papillomavirus types other than 16 and 18 in | |
cervical neoplasia. Arch Pathol Lab Med. | |
2018;142(6):693-5. | |
29. Boda D, Neagu M, Constantin C, | |
Voinescu RN, Caruntu C, Zurac S, et al. HPV strain distribution in patients with genital warts in a female population sample. Oncol Lett. 2016;12(3):1779-82. https://doi.org/10.3892/ol.2016.4903 |
|
30. Chen X, Li L, Lai Y, Liu Q, Yan J, Tang Y.Characteristics of human papillomaviruses infection in men with genital warts in Shanghai. Oncotarget. | |
2016;7(33):53903-10. https://doi.org/10.18632/oncotarget.9708 |
|
31. Luna-Aguirre CM, Reyes-Cortés LM, Torres-Grimaldo AA, Karr-De-León SF, Cerda-Flores RM, Melo-Nava B, et al. | |
Prevalence of human papillomavirus types in North and Central regions of Mexico. | |
Epidemiol Infect. 2018;146(13):1724-30. https://doi.org/10.1017/S0950268818001747 |
HPV genotypes | Primers (5’ to 3’) | Size (bp) |
HPV-54 | Forward: TTGCATCCACGCAGGATAGC | 386 |
Reverse: ACGTAGGCCAGCCTGTAGTA | ||
HPV-18 | Forward: CGTGGTCAGCCTTTAGGTGT | 95 |
Reverse: GAAACATTAGACGTGGCGGC | ||
HPV-16 | Forward: CGTGGTCAGCCATTAGGTGT | 643 |
Reverse: TGCCATTATTGTGGCCCTGT | ||
HPV-6 | Forward: AAAGTTGTTGCCACGGATGC | 204 |
Reverse: AGACGAGTCAGGCAATGCAA |
HPV genotypes | Number (%) of positive patients | Total | |
Female | Male | ||
HPV-54 | 2 (10.53%) | 1 (4.76%) | 3 (7.5%) |
HPV-18 | 0 (0%) | 0 (0%) | 0 (0%) |
HPV-16 | 6 (31.58%) | 0 (0%) | 6 (15%) |
HPV-6 | 11(57.9%) | 20 (95.24%) | 31 (77.5%) |
Total (%) | 19 (47.5%) | 21 (52.5%) | 40 (100%) |
Rights and permissions | |
![]() |
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License. |